Part:BBa_J23150:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

User Reviews

UNIQb4d4ce48f9f993d8-partinfo-00000000-QINU UNIQb4d4ce48f9f993d8-partinfo-00000001-QINU

Overview of Parts J23100-J23119 The J23100 to J23119 parts represent a series of constitutive promoters that were isolated from a small combinatorial library created by the iGEM team at Berkeley in 2006. These parts are valuable for various genetic applications due to their stable expression levels.

Part: BBa_J61002 encompasses all promoters from the J23100 family, except for J23119. This collection was integrated into the plasmid designed by the Arkin Lab in 2006, which includes the promoters from iGEM06_Berkeley. Notably, J23150 and J23151 were developed by Jason Kelly from the same group in 2008. These two parts contain specific point mutations that alter the sequences of J23107 and J23114, altering their functionality.

Promoter Efficiency in E. coli Strains While the efficiency of different promoters can vary significantly depending on the strain used, the work by the Tongji China team in 2021 demonstrated that J23104 was the most effective in the DHα strain of E. coli. We aim to build upon this finding by comparing two point mutations in promoters of the same promoter family against the performance of J23104.

Rationale for Using DH5α Over TG1 The choice of E. coli DH5α for our experiments, as opposed to the commonly used electrocompetent TG1, is significant. Although many characterized promoters have been tested in TG1, DH5α provides a range of transformation efficiencies and is adaptable to various workflows and budgets. Although traditional chemocompetent cells, such as DH5α, generally exhibit lower transformation efficiencies compared to their electrocompetent counterparts, they offer a cost-effective alternative. This allows for a more knowledgeable application of the promoters in a budget-conscious environment.

Experimental Approach Our experimental approach involved the use of KLD (kinase-ligase-dephosphorylation) technique to ligate PCR products from the pSB1A3_J23106-mTurquoise-B10015 CDSmut plasmid (mTurquoise fluorophore behind J23106 promoter). This involved amplifying the plasmid without the promoter itself but with overhangs that resembled the split promoters J23150 and J23151 to facilitate overhang ligation.

J23107 → J23150 J23150: tttacggctagctcagtcctaggtattatgctagc J23107: tttacggctagctcagccctaggtattatgctagc J23150 showed 114% of the fluorescence compared to J23104. The mutation significantly enhanced the promoter's strength, bringing it close to the previously strongest tested promoter within this family. J23114 -> J23151 = 14 % -> 98 % of J23104

J23114 → J23151 J23151: ttgatggctagctcagtcctaggtacaatgctagc J23114: ttgacagctagctcagtcctaggtattgtgctagc J23151 yielded 98% of J23104, highlighting a significant improvement as the mutation brought a weaker promoter almost up to the level of the strongest tested promoter. J23114 -> J23151 = 14 % -> 98 % of J23104